Научный журнал
Научное обозрение. Биологические науки
ISSN 2500-3399
ПИ №ФС77-57454


Мусаева А.К. 1 Егорова Н.Н. 1 Даугалиева А.Т. 1 Кожабаев М.К. 1
1 ТОО «Казахский научно-исследовательский ветеринарный институт»
Диагностические исследования на листериоз животных проведены с использованием бактериологических, биохимических, серологических и генетических методов, постановкой биопробы. Из патматериала павших животных выделена культура Listeria monocytogenes – возбудитель листериоза сельскохозяйственных животных. Культура Listeria monocytogenes обладала типичными биологическими свойствами: культуральные свойства на жидкой, твердой и дифференциально-диагностической питательных средах, морфология бактериальных клеток на окрашенных по Граму мазках, характерное сбраживание углеводов, каталазная и лецитиназная активность суточной культуры; по серологическим свойствам выделенная культура отнесена к 1-му серотипу семейства Listeria – Listeria monocytogenes. Биологические и молекулярно-генетические свойства изолята подтвердили идентификацию выделенной культуры Listeria.
биологические и молекулярно-генетические свойства
1. Кадымов Р.А. и др. Ветеринарная микробиология. – М.: Колос, 1982 – С. 195 – 197. 
2. Конопаткин А.А. Эпизоотология и инфекционные болезни сельскохозяйственных животных. – М.: Колос, 1984 – С. 205 – 210. 
3. Бакулов И.А., Котляров В.М. и др. К вопросу о таксономии бактерий рода Listeria // Ветеринария. – 1983. – №7. – С. 31-35.
4. Антонов Б. И. Лабораторные исследования в ветеринарии. – М.: Агропромиздат, 1986 – С. 151 – 169.
5. Хоулт Дж. Определитель бактерий Берджи. – М.: Мир, 1997, том 2. – С. 574 – 575.
6. Van Netten P. et al, 1989, Int. J. Food. Microbiol. 8(4):299.
7. Van Netten P., van Gaal B. аnd Mosel D. A. A., 1991, Lett. Appl. Microbiol., 12:20.

Цель исследований: изучить эпизоотическую ситуацию по листериозу в Алматинской области путем выделения и идентификации возбудителя болезни, вызвавшей гибель животных. При выявлении признаков поражения нервной системы, случаев абортов, мертворождения, повышенной температуры тела и падежа животных проводить бактериологические и серологические исследования на листериоз. Дать рекомендации по разрыву цепи природноочаговости листериоза путем изоляции больных животных, проведения профилактических мероприятий и дезинфекции, систематического уничтожения грызунов, кровососущих насекомых и клещей.

С 2009 по 2015 гг. в хозяйствах Алматинской области РК проводили исследования по обнаружению возбудителя листериоза у 1% животных. Ежегодно в стационарно неблагополучных хозяйствах области проводили бактериологические исследования биоматериала от больных и патматериала от павших животных по обнаружению возбудителя листериоза. Диагностические исследования проводились с использованием бактериологических, биохимических, серологических и генетических методов, постановкой биопробы.

Листериоз – инфекционная болезнь человека и многих видов животных, которая чаще всего встречается у овец и свиней, реже у крупного рогатого скота и коз, промысловых животных, пушных зверей, кроликов, домашних и диких птиц, лошадей, лисиц, хорьков, кур. Листериоз протекает либо в септической форме (кролики, морские свинки, мыши, поросята), либо с явлениями нервного синдрома и значительным расстройством центральной нервной системы (свиньи, крупный рогатый скот, овцы, лисы). Листериоз может сопровождаться абортами у крупного рогатого скота, овец и коз. Листериозу свойственны природная очаговость и стационарность.

В естественных условиях листериозом поражаются все виды домашних и диких животных. Основным резервуаром возбудителя в природе являются некоторые виды диких животных, но особенно грызуны. Листерии длительное время могут не только сохраняться во внешней среде – почве, навозе, воде, на растениях, но и размножаться, даже при низких (+4 °С) температурах. Некачественный силос является благоприятной средой для размножения листерий, особенно в его поверхностных слоях. Загрязненные листериями водоемы опасны в эпизоотологическом и эпидемиологическом отношении. Человек листериозом заражается в результате контакта с инфицированными грызунами, либо с сельскохозяйственными животными, особенно со свиньями, через поврежденную кожу; через пищеварительный тракт – при употреблении в пищу не подвергавшихся термической обработке ранних овощей, собранных с участков, где использованы для полива необеззараженные сточные воды и навоз. В результате инфицирования поражается нервная система и головной мозг человека. Внедрение листерий в организм человека может привести к развитию сепсиса, поражению отдельных органов и систем, а также к бессимптомному заболеванию. У женщин при поражении листериозом отмечаются аборты листериозной этиологии. Заболевание человека возможно также после употребления инфицированной пищи, в частности молока и мяса больных животных. Распространение листерий в организме происходит нейрогенным, лимфогенным, гематогенными путями. Листерии, распространяясь различными путями, преодолевая защитный барьер, проникают в головной мозг. У человека листериоз протекает в форме моноцитарной ангины и листериозного менингита, который во многих случаях заканчивается смертельно. Поражается центральная нервная система, отмечаются приступы судорог, возбуждение. Температура тела в начальный период заболевания повышена, а затем снижается. При листериозе у различных видов животных, а также у человека отмечается значительное повышение числа моноцитов в крови (отсюда и название Listeria monocytogenes). Гистологическое исследование мозга указывает на моноцитарную инфильтрацию [1,2,3,4].

В хозяйствах Алматинской области листериоз сельскохозяйственных животных встречается. По нашим данным, в стационарно неблагополучных хозяйствах, имеющих крупный и мелкий рогатый скот, листериоз обнаруживается у 10-30% исследованных животных. В Казахском научно-исследовательском ветеринарном институте из 10 проб, предоставленных из хозяйств Алматинской области РК в 2009 год выделен возбудитель листериоза в двух случаях (от 7 месячного теленка, 2-летней коровы), в 2011 году – в двух случаях (от 3-летней коровы, годовалой овцы); в 2014 году – в трех случаях (от 6 месячного теленка, овцы, 8 месячного ягненка); а в 2015 году – в двух случаях (от коровы и быка-производителя).

По данным Алматинского регионального филиала РГП (Республиканское государственное предприятие) «Республиканская ветеринарная лаборатория» в 2009 году из исследованных 3786 проб биоматериала от крупного рогатого скота возбудитель листериоза выявлен в 28 пробах; из 2384 проб от мелкого рогатого скота) – в 16 пробах.

Диагноз на листериоз ставят на основании комплекса эпизоотологических данных и результатов лабораторного исследования. Решающее значение принадлежит бактериологическому исследованию – выделению культуры листерий. Бактериологическая диагностика включает микроскопическое исследование исходного материала, посевы на питательные среды, идентификацию выделенных культур по культурально-морфологическим, биохимическим, молекулярно-биологическим и серологическим свойствам, а также постановку биологической пробы на лабораторных животных.

Материалы и методы исследования

Для бактериологического исследования на листериоз отбирается: головной мозг, доля печени, почка.

В патологическом материале с подозрением на листериоз – в паренхиматозных органах павших животных характерные патологоанатоми- ческие изменения: изменен цвет паренхимы печени, мягкой консистенции, бывает разложившаяся; селезенка кровенаполнена, темного цвета; паренхима почки мягкой консистенции, цвет изменен. Предоставленные патматериалы были отобраны от трупов животных. Заболевание протекало в острой форме и закончилось гибелью животных.

Бактериологические исследования проводили путем посева суспензии из головного мозга и паренхиматозных органов на физиологическом растворе в соотношении 1:5 на питательные среды МПБ (мясо-пептонный бульон), МПА (мясо-пептонный агар). При приготовлении сред для лучшего роста листерий добавляли 3 % сыворотки крови КРС, 3 % глюкозы и 2 % глицерина. Посевы культур выращивали в термостате при 25°С. Из головного мозга и печени готовили мазки-отпечатки. Мазки из суточных колоний листерий и мазки-отпечатки окрашивали по Граму.

Биохимические свойства выделенной культуры листерий, каталазную и лецининазную активность определяли общепринятыми методами, биопробу ставили на белых мышах и морских свинках. Для окончательной идентификации выделенных культур, выполняли генетические исследования по секвенированию 16S rRNA гена бактерии.

Предназначенные для идентификации 24 – часовые бульонные культуры, выращенные при 25˚С, бактериологической петлей засевали частым штрихом на 2 пробирки МПА, так, чтобы получить рост по всей поверхности агара, выращивали при комнатной температуре 24 – 30 часов. Затем агаровую культуру смывали небольшим количеством физраствора, чтобы получить густую взвесь (1 -1,5 млрд. м. к.
(микробных клеток) в 1 мл) для постановки РА – реакция агглютинации, пластинчатая реакция для серологической диагностики листериоза.

Для серологической идентификации выделенной культуры листерий использовали поливалентную листериозную агглютинирующую сыворотку, которая представляет собой смесь кроличьих листериозных агглютинирующих сывороток и содержит антитела Н-АВ и О-II, V, VI, VII, IX. Для проведения РА на чистое обезжиренное предметное стекло наносили две капли: каплю поливалентной сыворотки и каплю физиологического раствора (физраствора). К обеим каплям на стекле добавляли по одной капле смыва суточной культуры, смесь тщательно перемешивали бактериологической петлей, после чего стекла плавно покачивали круговыми движениями. Одновременно для контроля исследовали на стекле каплю сыворотки с добавлением капли физраствора.

Результаты исследования
и их обсуждение

Через 24 ч культивирования посевов в термостате при 25°С в МПБ наблюдалось легкое равномерное помутнение бульона, на МПА выросли колонии мелкие, росинчатые, блестящие, вязкой консистенции, в проходящем свете наблюдали нежный рост колоний – мелкие выпуклые беловатые колоний как беловатый налет на агаре.

Для выделения листерий из патматериала использовали МПБ, МПА с добавками. Через 24 ч при появлении сплошного роста колоний бактериоло- гической петлей производили пересев на селективную диагностическую среду Palkam. Через 24 часа инкубирования на селективной среде Pаlcam отмечался обильный рост мелких, серовато-зелёных или оливково-зелёных колоний с чёрным ореолом, диаметром 0,5–1,0 мм. Через 48 часов колонии диаметром
1,0-2,0 мм приобретали зеленую окраску с углубленными центрами, окруженными чёрным ореолом. При появлении сплошного роста колоний листерий производили пересев бактериологической петлей из зон наибольшего почернения среды штрихами на 2–3 чашки Петри с селективной дифференциально-диагностической средой для получения изолированных колоний. Бактериальную массу из выросших изолированных колоний использовали для окрашивания по Граму, проведения молекулярно-генетических исследований.

В окрашенных по Граму препаратах бактерии рода листерия установлены в виде коротких палочек, располагающихся одиночно и попарно. Возбудитель листериоза представляет собой грамположительные с закругленными концами палочки, которые могут быть полиморфными. Характерной особенностью листерий является то, что некоторые 2 бактерий располагаются по отношению друг к другу в виде римской цифры V или летящей чайки (важный дифференцирующий признак). Суточная культура листерий, выделенная от теленка, представлена на рис. 1


Рис. 1. Культура листерий в мазке, окрашенном по Граму

На рис. 1 видны мелкие грамположительные палочки с закругленными концами, которые являются полиморфными, располагаются по одиночке, попарно или группой клеток. Видны бактерий листерий, располагающихся в виде римской цифры V и летящей чайки.

Дальнейшую идентификацию возбудителя листериоза проводили путем определения подвижности методом висячей капли 12-часовой бульонной культуры, выращенной при комнатной температуре. Для установления подвижности листерий культуры выращивали на ПЖА при комнатной температуре, так как при культивировании при 37оС термолабильные жгутики у листерий разрушаются и подвижность их прекращается. На ПЖА отмечался характерный рост по линии укола в виде зонтика, в культуре листерий были подвижны.

При хранении патологического материала в холодильнике при +4°С происходит размножение и накопление листерий. Поэтому в качестве дополнительного диагностического метода использовали исследуемый материал в течение 30 дней для проведения повторных исследований через каждые 10 дней путем посева на МПБ и МПА. В трех повторностях посевов изолята выросли культуры листерий с характерными культурально-морфологическими признаками.

Изучением биохимических свойств установлено, что при посеве суточных культур на среды Гисса листерии ферментировали с образованием кислоты без газа глюкозу, рамнозу, салицин, левулезу, несколько медленнее -сахарозу, растворимый крахмал и глицерин; не ферментировали арабинозу, дульцит, инулин, сорбит; не образовывали индола и сероводорода, не разжижали желатин, не восстанавливали нитраты в нитриты. Определение каталазной активности листерий: к 1 мл суточной бульонной культуры и агаровой культуре добавляли 1 мл свежеприготовленной 5 %-ной перекиси водорода. Вследствие присутствия фермента каталазы у выращиваемой культуры перекись водорода разлагается с образованием кислорода (пузырьков газа). В наших опытах в пробирочной и пластинчатой реакциях агглютинации наблюдалось газообразование (бурлило), поэтому выделенная культура предварительно идентифицирована как Listeria.

Видовую идентификацию проводили методом определения лецитиназной активности листерий. К среде ГРМ №1, содержащей 5 % вытяжки желтка куриного яйца в 50 % содержании питательного агара, добавляли порошкообразный активированный уголь до концентрации 0,5 %. Для определения лецитиназной активности исследуемую культуру и контрольный штамм листерий пересевали штрихами в 2 чашки среды ГРМ №1 (без активированного угля) и 2 чашки с добавлением активированного угля. Инкубировали 48 ч при температуре 25°С, после чего чашки просматривали в проходящем свете и определяли наличие активности в присутствии активированного угля. Эталонный штамм Listeria ivanovii давала плотную зону помутнения независимо от присутствия активированного угля, Listeria monocytogenes образовывала аналогичную зону помутнения в присутствии активированного угля и не образовывала в отсутствие угля. Это биохимическое свойство отличает Listeria monocytogenes от других видов рода Listeria.

При серологической идентификации с помощью типовых сывороток определяли серотип идентифицированных культур листерий, учет реакции агглютинации (РА) производили в течение 3 мин, засчитывали появление в испытуемой капле хлопьев и отсутствие их в контрольных. Для этого чистую бульонную 24-часовую культуру листерий засевали в 2 пробирки с МПА и выращивали при 25°С 22 ч, смыв с агаровой культуры производили в 1 мл физраствора и ставили РА с типовыми сыворотками 1-го и 2-го серотипов. По результатам исследований выделенные листерий были отнесены к 1-й группе Listeria monocytogenes. Культуры листерий агглютинировались в РА на стекле с поливалентной листериозной сывороткой. Затем выделенные культуры листерий исследовали в РА одновременно с типовыми листериозными сыворотками 1- и 2-го серотипов (серологических типов) («серогрупп»). Сыворотка 1-го серотипа («серогруппы») содержит О-фактор II, а сыворотка 2-го серотипа («серогруппы») –
О- факторы V, VI.

У всех культур листерий отмечалась положительная реакция с сывороткой 1–го серотипа, что свидетельствовало о принадлежности культур к 1 –му серотипу («серогруппе»), а РА с сывороткой 2 –го серотипа была отрицательной. Этот метод позволяет судить о полноценности антигенной структуры листерий. Культуры, выделенные от павших мышей при постановке биопробы, испытывали в реакции агглютинации на стекле сначала с поливалентной сывороткой, затем определяли принадлежность к серотипу (1-й серотип и 2-й серотип). Культура принадлежала к 1 –му серотипу («серогруппе») – Listeria monocytogenes [5].

Способом усовершенствования идентификации и таксономической классификации бактериальных разновидностей является получение нуклеотидной последовательности 16S rRNA гена путем секвенирования ДНК бактерий. Данный метод позволит провести генетическую идентификацию рода Listeria путем генотипирования.

Методом ПЦР был амплифицирован фрагмент ДНК протяженностью около 1100 п.н.. ПЦР была выполнена универсальными праймерами 16SrRNA-190F 5’– AGCTAGTAGGTGGGGTAA-3 и 16SrRNA-1100R- 5’ TTACTAGCGATTCCGACTTCA в общем объеме 25 мкл. ПЦР смесь содержала 15 нг ДНК, 2.5х смеси, 5 пмоль каждого праймера и деионизированную воду 10 мкл. Программа амплификации ПЦР включала начальную денатурацию 94°С в течение 3 минут; 27 циклов: 94°С – 30 секунд, 60°С- 30 секунд, 72°С – 30 секунд; заключительную элонгацию 7 минут при 72°С. ПЦР программа была выполнена с применением амплификатора Mastercycler Gradient, (Eppendorf) [6,7].

Перед проведением реакции секвенирования для полученных фрагментов ДНК применяли ферментативный метод очистки. При ферментативном методе ПЦР продукты очищали от остатков олигонуклеотидов методом дефосфорилирования с помощью щелочной фосфатазы (SAP – Shrimp Alkaline Phosphatase, SibEnzyme) и эндонуклеазы Exonuclease I (Fermentas).

После ферментативной очистки ПЦР продукты были использованы для выполнения реакции секвенирования, очистки и разделения на автоматическом генетическом анализаторе ABI 3500. 

Нуклеотидные последовательности 16S rRNA гена идентифицируемого штамма Listeria monocytogenes от 6 месячного теленка были проанализированы в программном обеспечении SeqScape 2.6.0 (Applide Biosystems).

С учетом полученных результатов, были проведены дальнейшие исследования по проверке чистоты представленного штамма, которые были осуществлены на основе анализа ферограммы нуклеотидной последовательности 16S rRNA гена. Было установлено, что у анализируемого штамма отсутствует смешение сигналов, что свидетельствует об отсутствии в предоставленной культуре посторонних видов бактерий. На рисунке 2 в представлена ферограмма фрагмента нуклеотидной последовательности анализируемого гена Listeria monocytogenes.

Из рис. 2 видно, что проведенный анализ поз воляет сделать выводы об отсутствии перекрестной контаминации культуры Listeria monocytogenes посторонними бактериями.

Последовательности нуклеотидов, полученные с применением прямого и обратного праймеров были объединены в общую последовательность, используя программное обеспечение SeqMan. Последовательности праймеров и плохо разделенные концевые участки были удалены из анализа. В результате проведенного анализа была получена нуклеотидная последовательность протяженностью около 700 п.н. Полученная нуклеотидная последовательность была проанализирована с применением базы данных NCBI утилиты BLAST. Нуклеотидная последовательность и результаты идентификации представлены в таблице и на рис. 3. 


Рис. 2. Ферограмма фрагмента нуклеотидной последовательности гена 16S r RNA

Таблица 1

Результат идентификации гена 16S rRNA Listeria monocytogenes

Наименование штамма

Последовательность фрагмента
16S r RNA гена

Идентификация нуклеотидных последовательностей в международной базе данных (http://www.ncbi.nlm.nih.gov/) алгоритм BLAST

Инвентар-ный номер GeneBank (Accesion number) или коллекционный номер штамма

Наименование штамма

% совпа-дения

Listeria monocytogenes



Listeria monocytogenes 07PF0776 strain 07PF0776 

99 %


Listeria monocytogenes strain NCTC 10357 

99 %



99 %

Из табл. 1 следует, что данные Международного банка GeneBank [6] показывают высокую степень однородности нуклеотидной последовательности 16S rRNA изучаемого штамма с разновидностями рода Listeria (99 %).

Как видно из рис. 3, анализируемый штамм находится на одной филогенетической ветви с разновидностями рода Listeria.

Определение патогенности листерий Биопробу ставили на 3 белых мышах массой 16-18 г, которым подкожно вводили по 0,2 мл суточной бульонной культуры Listeria monocytogenes. На 3 сутки опытные животные пали. При бактериологическом исследовании патматериала от павших белых мышей чистая культура листерий высевалась из печени, сердца.

На 2 морских свинках ставили конъюнктивальную пробу введением в конъюнктивальный мешок по 0,05 мл суточной бульонной культуры Listeria monocytogenes. У морских свинок на 3 сутки развился кератоконъюнктивит и светобоязнь.

В результате проведенных исследований установлено, что эпизоотическая культура Listeria monocytogenes, полученая из патматериала от теленка, коровы, быка-производителя, обладала типичными культурально-морфологическими, биохимическими и антигенными свойствами и по результатам серологических исследований отнесена к 1 серотипу. По биологическим свойствам эпизоотический изолят был идентичен эталонному музейному штамму. Методом генотипирования была установлена однородность нуклеотидной последовательности 16S rRNA изучаемого штамма с разновидностями рода Listeria (совпадение 99 %).


Рис. 3. Филогенетическое древо, построенное на основании фрагмента гена 16S rRNA


Таким образом, диагноз на листериоз был поставлен на основании клинико-эпизоотологических данных, характерных культуральных и морфологических свойств, тинкториальных свойств, биохимических свойств (отношение к белкам, углеводам, каталазной, лецитиназной активности и т.д.), молекулярно – генетических свойств (проведения генотипирования методом ПЦР), положительной реакции агглютинации с поливалентной и типовой листериозными сыворотками и отсутствием агглютинации в контроле с физраствором, а также в результате изучения биологических свойств с постановкой биопробы на лабораторных животных.

Решающее значение для профилактики листериоза имеет вакцинация животных. Животных всех видов прививают вакциной сухой живой против листериоза животных из штамма «АУФ». Также необходимо, комплектовать стадо животными из благополучных по листериозу хозяйствующих субъектов. Не допускать ввода вновь поступивших животных в общее стадо без предварительного изолированного содержания их в течение 30 дней.

Во время изолированного содержания, при формировании новых групп в хозяйствующих субъектах или населенных пунктах необходимо проводить клиническое обследование животных и при необходимости (при выявлении признаков поражения нервной системы, абортов, повышенной температуры тела) бактериологические и серологические исследования на листериоз. Систематически проводить уничтожение грызунов, кровососущих насекомых и клещей. Вести строгий учет случаев абортов, мертворождения и падежа животных и направлять патологический материал на исследование в ветеринарную лабораторию.

Библиографическая ссылка

Мусаева А.К., Егорова Н.Н., Даугалиева А.Т., Кожабаев М.К. ДИАГНОСТИЧЕСКИЕ БАКТЕРИОЛОГИЧЕСКИЕ ИССЛЕДОВАНИЯ ЛИСТЕРИОЗА ЖИВОТНЫХ И ГЕНОТИПИРОВАНИЕ ЛИСТЕРИЙ // Научное обозрение. Биологические науки. – 2016. – № 1. – С. 83-89;
URL: https://science-biology.ru/ru/article/view?id=988 (дата обращения: 09.12.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074